<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-677887814877325122</id><updated>2012-02-16T14:01:15.288-08:00</updated><category term='Scientists'/><category term='Muslim'/><category term='Civilization'/><category term='Islamic'/><title type='text'>Palestinian M.D.</title><subtitle type='html'></subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>6</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-677887814877325122.post-5184641125175705683</id><published>2008-11-14T09:04:00.000-08:00</published><updated>2008-11-14T11:44:27.519-08:00</updated><title type='text'>Do You Ever Wonder? Human Hearing</title><content type='html'>&lt;div face="arial" style="text-align: justify;"&gt;There is an infinite number of topics that can be  extracted from the Human Body. One can never start to even begin to describe any part of it in a finite sense of detail. It simply is an endless well of constant fascination. However, one has to start somewhere.&lt;br /&gt;&lt;br /&gt;Do you ever wonder how you actually manage to hear things? If you do, and you would like to know how that process happens in a concise fashion using mostly non-complicated terminology, keep reading.&lt;br /&gt;&lt;br /&gt;The Human sense of hearing is a complex process that involves physical parts and electronic apparatus that all work in a synergistic fashion to ultimately stimulate the proper nervous cells in the Cerebral cortex (i.e. the brain) to produce the sense of hearing.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://upload.wikimedia.org/wikipedia/commons/7/7c/HumanEar.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 403px; height: 252px;" src="http://upload.wikimedia.org/wikipedia/commons/7/7c/HumanEar.jpg" alt="" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;It all starts in our external ear. The external ear carries the function of a large dish that can maximize the amount of sound waves received and funneled into the external ear canal. The external ear canal is the part of the ear that you clean from produced wax, and is largely empty space that solely functions as a funnel for sound waves to the middle ear.  At the end of this canal we come to what is called the tympanic membrane which most recognize as the ear drum. It's just like a membrane on a regular drum, except much finer, and attached to a set of bones that move in accordance to the vibration of that membrane.&lt;br /&gt;&lt;br /&gt;The bones that are within the middle ear, are the smallest bones in the human body, and are exquisite in nature. They conduct sound waves by motion to the the inner ear,  through a small hole with a membrane called the elliptical window. The mechanical vibrations end up pressuring the elliptical window of the inner ear.&lt;br /&gt;&lt;br /&gt;Now the simplistic part is done, here comes the more fascinating part of this little story. How does the inner ear actually converts what used to be sound waves, into electrical signals?&lt;br /&gt;&lt;br /&gt;Musicians might love to know more about this part of the ear. Within the inner ear is a tremendously intricate structure. It really is a musical instrument. The inner ear is to, put it simply a fine series of tubes. There are two main functions to it, the first is to convert sound into electric signals that can be understood by the human brain, and the second is to give the person a sense of position and aid in balance.&lt;br /&gt;&lt;br /&gt;So how does such a small organ achieve such tremendous objectives? Within the series of tubes is a very small membrane called the Tectorial membrane. This membrane is floating within a very special liquid called the endolymph. This fluid contains strictly balanced concentrations of certain electrolytes, which is critical to the process of eliciting electric signals from specialized cells. If the balance &lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.roger-russell.com/hearing/cochlea2.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 400px; height: 260px;" src="http://www.roger-russell.com/hearing/cochlea2.jpg" alt="" border="0" /&gt;&lt;/a&gt;of electrolytes is even slightly adjusted it could completely interrupts the entire process.&lt;br /&gt;&lt;br /&gt;Another membrane is located within the same series of tubes called the Basilar membrane. This one is lined with cells that have specialized fine hairs we call cilia, that brush gently on the lower surface of the Tectorial membrane. The Basilar membrane is narrow and stiff at the root, thinner and compliant at the tip. As the pressure runs through the convoluted tube, the Basilar membrane starts to vibrate depending on the quality of that wave. If the wave was of high frequency, then as it reverberates through the tube, it will cause that part of the Basilar membrane that matches its frequency to vibrate. It literally is a musical instrument, where the pressure wave acts like the human finger trying to reach to that note that best matches it on the piano key that is the cell attached to the Basilar membrane.&lt;br /&gt;&lt;br /&gt;Now, as the Basilar membrane vibrates at region corresponding to the frequency of the transmitted wave, the speciallized hair cells at that particular area start to get their hairs bend against the Tectorial membrane. When the hairs bend, special channels on that hair cell open, which culminates into an electrical impulse to be generated on that particular cell. It is then sent through a specialized nerve to the brain stem, and eventually ascends to the cerebral cortex. Each hair cell is ultimately connected to a specific area in the cerebral cortex that corresponds to its frequency. If that part of the brain is stimulated, the person "senses" that sound based on which sort of cells were stimulated in the process.&lt;br /&gt;&lt;br /&gt;Enjoy this video which displays the entire process in a neat 3D animation:&lt;br /&gt;&lt;br /&gt;&lt;center&gt;&lt;object width="425" height="344"&gt;&lt;param name="movie" value="http://www.youtube.com/v/dyenMluFaUw&amp;amp;hl=en&amp;amp;fs=1"&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;param name="allowscriptaccess" value="always"&gt;&lt;embed src="http://www.youtube.com/v/dyenMluFaUw&amp;amp;hl=en&amp;amp;fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;/center&gt;&lt;br /&gt;&lt;br /&gt;That is, in a nutshell how the process of Human hearing occurs in the simplest of terms I could possibly think of.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-style: italic; color: rgb(51, 51, 255);"&gt;P.S. I have restored the older articles I wrote that were deleted on &lt;/span&gt;&lt;a style="color: rgb(51, 51, 255); font-style: italic;" href="http://palestinianmd.blogspot.com/"&gt;&lt;span style="color: rgb(255, 0, 0);"&gt;my blog&lt;/span&gt;.&lt;/a&gt;&lt;span style="font-style: italic; color: rgb(51, 51, 255);"&gt; I will miss the comments on them though.  Feel free to comment on my blog, but the comments will be moderated because I wish to refer family, friends and colleagues to it. Try to be cordial and stay on topic on the blog. It goes without saying that you are free to say whatever you want on shoutwire though. Also please notify me to any mistakes I commit. &lt;/span&gt; &lt;br /&gt;&lt;br /&gt;&lt;span style="font-style: italic; color: rgb(51, 51, 255);"&gt;Additionally, feel free to send in any medical questions you have that you like to see answered in a weekly editorial, where I will pick 5 questions, and will try to answer them to the best of my knowledge, in simple terms and will cite sources in the process. Send them to:&lt;/span&gt; &lt;span style="color: rgb(255, 0, 0);"&gt;medfreaky@gmail.com&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/677887814877325122-5184641125175705683?l=palestinianmd.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/5184641125175705683/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=677887814877325122&amp;postID=5184641125175705683' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/5184641125175705683'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/5184641125175705683'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/2008/11/do-you-ever-wonder-human-hearing.html' title='Do You Ever Wonder? Human Hearing'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-677887814877325122.post-3628649929153467515</id><published>2008-11-14T08:52:00.000-08:00</published><updated>2008-11-14T08:53:02.872-08:00</updated><title type='text'>The Most Ancient Language in The Universe</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;center&gt;&lt;b&gt;The Most Ancient Language in the Universe&lt;/b&gt;&lt;/center&gt;&lt;br&gt;&lt;br&gt;Arabic, Latin, English, Hebrew, Aramaic and Persian are all well known languages, but can there be a language that predates humanity itself by millions of years? Before we answer that question, we need to figure out what “Language” actually is. Some say it is a set of visual symbols, auditory sounds or tactile markings that serve the purpose of documentation and communication. Some would like to add the fact that  language is a strictly human trait, and other life forms may have some sort of communication, but did not rise up to the level of becoming a language. I will not try to argue on behalf of microbes, plants or even animals. No, I will argue on behalf of Life. &lt;br&gt;&lt;br&gt;The language of life is the Genetic Code. It is indeed a very sophisticated linguistic system that provides the means for documentation and communication not only between cells of the same species, but also between different life forms.  The Genetic code documents every single evolutionary advancement in various organisms, and preserves that advancement for future siblings of that species.&lt;br&gt;&lt;img src="http://upload.wikimedia.org/wikipedia/commons/1/16/DNA_orbit_animated.gif" space="10" vspace="10" align="right" hspace="10" /&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;What is the Genetic Code?&lt;/u&gt;&lt;/b&gt;&lt;br&gt;&lt;br&gt;The Genetic code is basically a long chain of molecules that are formed by four different kinds of molecules we call &lt;i&gt;nucleotides&lt;/i&gt;, similar to the letters of the alphabet. Most of you have probably heard of the binary language in modern computers which is composed of a chain of zeros and ones that are meant to execute a certain function or store a certain piece of information for future retrieval. So a typical looking strip of binary code would look like:&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;i&gt;1101110101011101111100101110&lt;/i&gt;&lt;/b&gt;&lt;br&gt;&lt;br&gt;Similarly, the Genetic Code is a chain made of four different nucleotides; Adenine, Guanine, Thymine and Cytosine (A, G, T and C), that are attached to each other to form a single long strand of DNA. Each of those nucleotides has a natural complementary nucleotide we call a base pair. So a C would always pair with a G, and an A would always pair with a T. Thus each strand would have a mirror image of complementary DNA strand. Since one strand is enough to know how the other strand looks like, we need to only list the sequence of one strand to make out the genetic code. A typical genetic code strip would look like this:&lt;br&gt;&lt;br&gt;&lt;center&gt;&lt;b&gt;&lt;i&gt;CGATTCATGTATGCTGAGACTAGCCTCACGGAGCT&lt;/i&gt;&lt;/b&gt;&lt;/center&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;How exactly is this a language?&lt;/u&gt;&lt;/b&gt;&lt;br&gt;&lt;br&gt;Well the DNA itself is not a language, it is a storage medium of the genetic code similar to a hard disk in your PC. But what it stores, is the language that codes how to create a life form from scratch. It is a language in the sense that it contains a set of symbols signified by a pattern of nucleotides that serve the purpose of documenting the life form’s entire structure, and is universally understood by all cells known in existence.&lt;br&gt;&lt;br&gt;For example, Insulin, which is a hormone that is important in sugar regulation, is also an important drug to treat diabetics. It is a protein, which is coded for by a gene (a segment in the DNA that is designated for a certain function or codes a molecular structure, mostly proteins).  The way we produce it, is by taking a “refined” copy of the human DNA and place it inside a simple bacterial cell. Then the bacteria are grown in cultures and eventually we will have massive amount of bacteria that is capable of producing Insulin in &lt;a href="http://www.blogger.com/%20http://www.sciencemag.org/cgi/content/abstract/219/4585/632"&gt;[1]&lt;/a&gt;. The important point to note here is that the simplest of life forms, bacteria, are capable of understanding the genetic code of one of the most complex life forms in existence, a Human Being. This is a prime example of how universal the Genetic code is as a language.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;How do organisms decode the Genetic code?&lt;/u&gt;&lt;/b&gt;&lt;br&gt;&lt;br&gt;Trying to avoid all the technicalities might be difficult here, but I will try to simplify as much as possible. As we mentioned earlier, the DNA is a set of molecules of four types. The “coding” part of the DNA is coded in non-overlapping triplets. So basically each three molecules (e.g. ACT) corresponds to a certain amino acid, the building block of proteins. A gene would code for the entire amino acid chain that would form a protein. Cells have the machinery to recognize each triplet and what amino acid it corresponds for. This code is universal to all living cells, from Bacteria all the way to Human cells.&lt;br&gt;&lt;center&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/GeneticCode.png" space="10" vspace="10" align="center" hspace="10" /&gt;&lt;/center&gt;&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Can you at least tell me some interesting facts about the DNA?&lt;/u&gt;&lt;/b&gt;&lt;br&gt;&lt;br&gt;Alright:&lt;br&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/chromosome2-1.jpg" space="10" vspace="10" align="right" hspace="10" /&gt;&lt;br&gt;• Each cell has on average 6,000,000,000 base pairs forming the genetic code. If we want to write each base in letters, then we can simply consider each one to be the equivalent of a single byte. Taking that into consideration, each cell of yours actually contains the equivalent of an astonishing 6 GBs of data. Now take the fact that each human body is formed of roughly 10,000,000,000,000 cells, and each cell has a copy of the human genome, that computes into 60,000,000,000 Terabytes of Data! So basically, each human contains more data than entire computer mainframes spanning a few buildings. &lt;a href="http://www.blogger.com/%20http://hypertextbook.com/facts/1998/StevenChen.shtml"&gt;[2]&lt;/a&gt;.&lt;br&gt;&lt;br&gt;• Each base pair is roughly 0.34 × 10-9 m long. If we unravel all the base pairs that make the DNA in one single human being and line them up next to each other in a single line, each human would have enough DNA to make 67 round trips to the sun, 52000 trips to the moon and enough to wrap it around the earth’s circumference 500,000 times! &lt;a href="http://www.blogger.com/%20http://hypertextbook.com/facts/1998/StevenChen.shtml"&gt;[2]&lt;/a&gt; &lt;a href="http://www.blogger.com/%20http://www.nasa.gov/worldbook/moon_worldbook.html"&gt;[3]&lt;/a&gt;&lt;br&gt;&lt;br&gt;• The cell is capable of replicating the entire genetic code, while making less than a single error in a billion copied base pairs. That is like copying 1 Gigabyte of data and making an error of one byte.&lt;a href="http://www.blogger.com/%20http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.section.754"&gt;[4]&lt;/a&gt;&lt;br&gt;&lt;br&gt;• More than 90% of the Human DNA is either of no function, redundant, or of unknown function.&lt;br&gt;&lt;br&gt;• The DNA is a great museum that documents evolutionary changes. For example, Apes in general have 48 chromosomes, while Humans carry only 46 chromosomes. About 18 years ago, scientists discovered that two chromosomes in Apes fused together to form the second chromosome in humans. This fusion lead to the fact that Humans have one pair of chromosomes less than other descendents of apes.  &lt;a href="http://www.blogger.com/%20http://genome.cshlp.org/cgi/content/full/12/11/1663"&gt;[5]&lt;/a&gt;&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Final thoughts :&lt;/u&gt;&lt;/b&gt;&lt;br&gt;&lt;br&gt;The Genetic code could very well be the oldest and most sophisticated language to date, and we have yet to understand a fraction of it. In essence, the Human body is far more sophisticated than what its inhabitant gives it credit for.&lt;br&gt;&lt;br&gt;&lt;i&gt;P.S. If you like to do further reading, you may start by checking the links to the sources I cited.&lt;/i&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/677887814877325122-3628649929153467515?l=palestinianmd.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/3628649929153467515/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=677887814877325122&amp;postID=3628649929153467515' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/3628649929153467515'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/3628649929153467515'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/2008/11/most-ancient-language-in-universe.html' title='The Most Ancient Language in The Universe'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-677887814877325122.post-6897289262305965786</id><published>2008-11-14T08:51:00.000-08:00</published><updated>2008-11-14T08:52:27.162-08:00</updated><title type='text'>"Supranatural" Science To Die at The Podium of Heathens</title><content type='html'>Let me begin by reintroducing who I am. I am an Atheist, who was raised as a Sunni Muslim, but gradually slipped into the heathen ways of Atheism during the long 7 years of Medical School. Currently I am an Internal Medicine Resident at a specialized Cancer center. This is a response to many of the points that I consider to be blatant erroneous scientific assumptions made in &lt;a href="http://www.shoutwire.com/comments/full/184777/Atheism_Vs_Theism"&gt;final flash's last editorial.&lt;/a&gt; Considering the fact that he is a Sunni Muslim, I found myself to be in a perfect position to reply.&lt;br&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/the-atheist-e.jpg"  vspace="10" hspace="10" align=right space="10"/&gt;&lt;br&gt;Firstly, let me start by saying that Atheists are some of the toughest people to lump in a single group, partly because they do not share anything apart from the lack of belief in a supranatural mythical being, and partly because they come from so many variable backgrounds and over many generations.  So let me take this opportunity to distance myself from much of the ridiculous religion bashing that happens on Shoutwire and other venues of the interwebs. I certainly do not support the typical angry teen who wants to go against the “establishment” stereotype. In fact on many occasions on this site I have put the view point of certain religions to the table, including the view point of Muslims. I will not even try to put arguments for atheism, because my point is not preaching, but an adequate response to what I considered substantial errors of science by a student studying a facet of science. There is no one that speaks for atheists in their entirety, so I will not attempt to speak for such a group. However I will speak for myself and similarly minded people.&lt;br&gt;&lt;br&gt;Religion has nothing similar to science, neither in definition, nor in content. Science cannot have “supranatural” aspects, because one or part of the definition of science is the observation, definition and explanation of the natural. The “Supranatural” is in essence an experience, occurrence or a claim that goes against the natural, as documented by the experience of humanity. Religion deals with many supranatural claims, such as the stories of mythology dealing with Greek gods, or in Islam where Mohammad is said to have traveled to Jerusalem then to the Heavens in one night. Now that we have established that Religion deals with the supranatural, we can move to Science.&lt;br&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/ball.gif"  vspace="10" hspace="10" align=right space="10"/&gt;&lt;br&gt;According to Final Flash, Gravity is a supranatural concept. That is a strange fallacy to come from a student of science. Gravity is an observation of how variable masses interact with each other. Gravity is defined, consistent and reproducible. Meaning, if I threw a ball from the top of a building, it will always fall down, towards the earth, at a fixed acceleration if one is to ignore air resistance and terminal velocity. That is the very definition of the natural. Natural observations are not necessarily entirely understood or explained. But one cannot deny that it is natural. If I threw the ball from above a building, none of the observers will be surprised, or as much flinch, if the ball simply followed what we have experienced in nature, which is the ball falling straight to the ground. However, if I looked at the ball, and managed to levitate the ball from a distance, that would be supranatural. Observers will be astonished, because that defies what they have observed during their entire life, it defies nature. If I bring humans from 2000 years ago, and from today both would agree on how a dropping ball is a natural observation, and how a levitating ball is a supranatural observation, despite the fact that humans from today are far more inclined to understand the mechanics behind it. The “Supranatural” is not what humans cannot explain, but it is what goes against the normalcy of everyday life and experience. &lt;br&gt;&lt;Center&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/levitation.jpg?t=1218809173"  vspace="10" hspace="10" space="10"/&gt;&lt;/Center&gt;&lt;br&gt;Physical laws are a number of laws that may not be entirely accurate, but are based on observation of what has occurred in nature. If what is predicted by those laws is adequately reproduced in nature, or the laws sufficiently describe or at least approximately model it, then they are followed by the scientific community. The laws of Physics are not “Religion” for the simple fact that they can be reproduced and corroborated. If the laws of Physics, or any scientific modality for that matter, fail at describing a certain event or observation, further refinement and laws are put in place. Religion on the other hand, is a claim, made by certain individuals, with no way of reproducing, corroborating or proving, and requires its followers to believe it absolutely, completely and without any refinement or peer review. For example, Muhammad claimed to have traveled to Jerusalem and to the heavens in one night. No one saw that, no one recorded it, but religious followers are expected to believe it happened without any question, despite it negating any logical means of transportation at that time. Attempting to compare Religion and Science in any light to give an impression they are anything alike, will always fall flat on its head. Any Religious person should concede this aspect of the argument. Stop comparing Science and Religion, and do not even try to use the words “Religion” and “Science” interchangeably as if they meant the same thing, because it really undermines your argument and sheds a bad light on your scientific qualifications. &lt;br&gt;&lt;br&gt;Theists and Atheists both deride religion. Atheists do not really bash the fact that Religion is too simplistic when it attempts to explain scientific issues, at least not the well researched and educated atheists. The problem entirely started when religious institutions such as the Catholic Church directly intervened with any scientific achievement that would contradict its literal understanding of creation. Islam did deal differently with scientific advancement than the Christian institution, but it is fraught with its own set of problems. The problem with religions is that they sometimes entirely contradict what science discovered, and yet the religious people are not willing to refine those contradictions or entirely dispose them. &lt;br&gt;&lt;img src="http://www.chrysler.org/images/Adam&amp;Eve.jpg"  vspace="10" hspace="10" align=right space="10"/&gt;&lt;br&gt;A very simple and shared story amongst Islam and Christianity is the story of Adam and Eve. The famous story, with which the first two human beings were created in heaven, then cast to earth after they sinned. It is clear that this story defined the beginning of the Human race. In addition, it has put forth the idea that Humans started as an exact copy of the sentient beings that we are now. The question is this. Is it another concept people have taken too literally? Did Adam and Eve even exist? Did the story even occur? Evolution clearly contradicts this story, because evidence shows that humans were of an apelike ancestry, and that they gradually transformed to what they are now over millions of years. There was no sharp cut point at which Humanity was created. Now if it should be taken literally, then there is a direct contradiction with what Religion claims, and what Science predicts. If it should be taken metaphorically, does that mean that religious people were mislead all these centuries since the inception of this story? Even worse, who decides what should be considered a “metaphor” and what should be considered “literal”? &lt;br&gt;&lt;br&gt;The “enlightened” religious individuals like to dismiss anything that contradicts science by claiming it was a metaphor and should not be taken literally. Why do you have to go to Mecca to complete a pilgrimage? Maybe Mecca was a metaphor to a point of unity, a capital of some sort, and you can actually visit any capital in the world such as London, Paris or even Washington DC to complete an Islamic Pilgrimage. You see, when you set yourself down the path of “metaphors” and “literality” there are no guidelines to which one would adhere, and the arguments could get so ridiculous, to an extent they can be similar to my last example. &lt;br&gt;&lt;br&gt;Another problem with “Scientific” claims by religion is the fact that those elements are nothing more than backpedaling through thousands of obscure and vague statements that can be morphed into what you like in order to support your claim that religion has scientific proof. If you do not want any criticism regarding the “Scientific” claims of Religion, then stop touting them as evidence for your religion, because they simply are not. Do not cherry pick what you like and dismiss what you dislike as a “metaphor” and just admit that Religion is not science, never has been, and never will be.&lt;br&gt;&lt;br&gt;It is true, that it can be ridiculous to claim that “Religion is the root of all evil”. However, it can’t be denied that Religion was behind some of the most brutal and evil actions in the history of Humanity. The issue with religion, is that people are expected to follow it, accept it and abide by it in its entirety, because defying one aspect of it is as blasphemous as defying the entire religion.  Religion was the prime motivation behind the crusades, and religion is the subject that motivates the lunatics of this world such as Bin Laden. Did they misuse Religion? Perhaps. But the fundamental issue here is that the “absolute belief” system works entirely to the advantage of crazed lunatics. “Absolute belief” is the major issue behind why the concept of Religion has lead to blind hate and atrocious actions in history. If Religion did not promote that concept, if it was acceptable to throw and dismiss that part of Religion which goes against the acceptable moral conduct of Humanity, and promote what is acceptable moral conduct then we would have much less ammunition to criticize religion. &lt;br&gt;&lt;br&gt;Another issue with Religion is the fact that people tend to deal with it as if it was this separate entity that exists in its own boundaries, detached from humans and their actions. But from an Atheist's viewpoint, Religion is nothing but the work of Humans. Humans are the ones that set what religion is, and they manipulate it to their own gains. Or at least the influential ones in that Religion do, while the vast masses of followers just accept what those certain individuals have said, and follow it regardless of rationale or evidence. &lt;br&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/EgyptianWallRelief.jpg?t=1218808837"  vspace="10" hspace="10" align=right space="10"/&gt;&lt;br&gt;Please do not even attempt to put “reasons” as to why people do not believe in the existence of a certain supranatural being. One famous Atheist puts it this way, not exactly his quote but the point is the meaning. Being a follower of a certain religion, you are in essence an atheist to every other religion in history. You do not believe in Greek Mythology, you do not believe Egyptian gods, you do not believe in ancient pagan religions of the Arab peninsula. Atheists just add one more to the list of supranatural beings you do not believe in to their list, which is your god. &lt;br&gt;&lt;br&gt;When we choose to be Atheists, we only choose to be freed from the archaic and false obligations set by ancient mythology that religious people choose to continue to follow. However, we most certainly do not set our own “individual” rules. We follow the most important set of rules, the law, a consensus of what is acceptable and unacceptable at the time, which has to be secular and devoid from any religious influence. Your second reason which is lack of being able to “imagine” anything that is not physical is so false on so many levels, mainly because I can easily imagine anything. I just imagined that the Earth is flat, set on the back of a huge turtle. The difference is, I would not go to believe what I imagine is actually real because I know that my imagination is not what sets scientific belief. &lt;br&gt;&lt;br&gt;Finally, yes an adherent of Religion can actually do “good” deeds. Of course they are capable of that, just like every other human. You gave an example that Islam asks you to pray 5 times a day, give a certain percentage of your fortune to help the poor etc. It all sounds good, but what about the way Islam treats the gays? God punished them by death according to stories in the Quran. What about the way Islam treats religions that are not monotheistic? Pagans are requested to convert, or die. What about the way Islam punishes pre-marital sex or extra-marital sex? If you have premarital sex you are to receive hundreds of lashes, and if you have extramarital sex you are to be punished by death. At this day and age, none of these religious laws fit the consensus, and should be dismissed entirely. When Religious people finally stop taking their Religion as the absolute truth, and finally accept to move beyond those laws, and choose what is acceptable and what is not, is exactly the point where Religion ceases to be a religion, and becomes the secular law we have today.&lt;br&gt;&lt;br&gt;&lt;i&gt;P.S. I am not really back. I will however drop by every now and then and gtfo before the lulz kill me. Turns out I am allergic to it.&lt;/i&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/677887814877325122-6897289262305965786?l=palestinianmd.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/6897289262305965786/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=677887814877325122&amp;postID=6897289262305965786' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/6897289262305965786'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/6897289262305965786'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/2008/11/supranatural-science-to-die-at-podium.html' title='&quot;Supranatural&quot; Science To Die at The Podium of Heathens'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-677887814877325122.post-8109417642625556590</id><published>2008-11-14T08:50:00.000-08:00</published><updated>2008-11-14T08:51:02.583-08:00</updated><title type='text'>Sex: Simplified</title><content type='html'>&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/gender-1.jpg"  vspace="10" hspace="10" align=right space="10"/&gt;&lt;br&gt;Most of you probably grew up in a family where sex is a very simple thing to understand. Males are males, and females are whatever males hate on. Things sound quite simple. But in reality, these issues are not as simple as they seem at first glance. This whole issue of defining what sex ,or rather gender, is , is one of the most complicated subjects known to medicine both ethically and scientifically speaking. I will attempt here to explain these issues in general non-medical terms, or rather in English to the best of my limited knowledge.  This whole idea is an expansion to a comment I made earlier on &lt;a href="http://www.shoutwire.com/comments/165638/Pregnant_Man_Chick_Thomas_Beatie_Having_Kid_in_Four_Weeks.html"&gt;Steelydan’s editorial.&lt;/a&gt;&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;i&gt;“Sir, your wife had a beautiful baby” &lt;br&gt;&lt;br&gt;“Thank you! Is it a Girl? I always wanted a girl…”&lt;br&gt;&lt;br&gt;“Er, at the moment, we can’t tell… give us a few hours though, we might”&lt;br&gt;&lt;br&gt;“What? You mean I can't call her Jane yet?”&lt;/b&gt;&lt;/i&gt;&lt;br&gt;&lt;br&gt;I am sure most of you never saw this conversation before in a Hollywood movie. But it is indeed a nightmare to the parents. In addition, this conversation is quite more common than you are inclined to believe. So the issue comes down to, what exactly was wrong with the Baby? Sometimes this question is asked years after the birth of a child, and sometimes this question would never be asked until a person finds that s/he is infertile. The question maybe answered only hours after the delivery of the baby, and it may not be answered except months after. &lt;br&gt;&lt;br&gt;So let’s move on, what exactly is Gender? There are many definitions to Gender:&lt;br&gt;&lt;br&gt;&lt;b&gt;Chromosomal Gender:&lt;/b&gt;&lt;br&gt;&lt;br&gt;The DNA, the essential data that defines a human being, is packed into very well compressed zip files known as chromosomes, which are basically the coiling of the strands of DNA. Now you all heard of the XX, XY, gender cut line, where XX is a female designation and XY is the male designation. But is it so simple? Well it isn’t. There are people that have XXX, XXY, and single X. What makes matters even worse is the fact that on some occasions, genes on the Y chromosome can cross to the X chromosome, making the Y chromosome lacking the male attributes, and having an XY female. &lt;br&gt;&lt;br&gt;&lt;center&gt;&lt;img src="http://durhamregion.typepad.com/photos/uncategorized/chromosome.jpg"  vspace="10" hspace="10"/&gt;&lt;/center&gt;&lt;br&gt;&lt;br&gt;The XY females look completely like females, are psychologicaly developed as females, and they posses the exact female genitalia. In fact many go undiagnosed till they notice they don't get periods or that they are infertile.&lt;br&gt;&lt;br&gt;&lt;b&gt;Physiologic Gender:&lt;/b&gt;&lt;br&gt;&lt;br&gt;Sometimes, despite the correct XX or XY chromosome, a fetus gets exposed to high levels of a certain hormone during pregnancy, like for example a female getting exposed to high levels of androgens (to put simply the male hormones). So basically what happens if a female gets exposed to male hormones during pregnancy? The genitals stop looking like they should, and you get an oversized clitoris that looks close to a penis but not close enough. Basically it gets the medical staff saying &lt;i&gt;“What the fuck do we tell the parents now?”. &lt;/i&gt;&lt;br&gt;&lt;br&gt;There are many causes to this problem. Some of which are related to the genetic lack of enzymes responsible for proper conversion of hormones in the adrenals. Other causes include the the mother taking steroids or androgens during pregnancy. The situation can be relatively corrected with proper hormonal therapy of the child if the condition is diagnosed early on.&lt;br&gt;&lt;br&gt;&lt;b&gt;Physical Gender: &lt;/b&gt;&lt;br&gt;&lt;br&gt;It is simply gender that is designated by the appearance of the genitalia. If a baby has a dick and balls, we call a male, and if it has a vaginal orifice, it’s called a female. That sounds simple. But in reality it could be very confusing. What if the scrotum was split and the penis was small, what if the labia were fused and the clitoris was oversized? The few hours after birth are some of the tougher hours parents must face. &lt;br&gt;&lt;br&gt;How are these issues resolved? This is mostly done by looking at the reproductive functions of the baby, whether it possesses a reproductive system that would serve as a female or as a male. Sometimes things are even tougher, and the Doctor just has to make the call, and eventually further surgeries to make the gender closer to what is designated by the medical staff and agreed upon by the parents.&lt;br&gt;&lt;br&gt;&lt;b&gt;Psychological Gender:&lt;/b&gt;&lt;br&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/cognitivepsychology-1.jpg"  vspace="10" hspace="10" align=right space="10"/&gt;&lt;br&gt;This is a subject that was largely a mystery until recently. Hormonal exposure during pregnancy not only affects the development of the physical features of a Human being, or their reproductive organs, but also the development of the Brain functions that provide specificity to a women or a man. It decides to which gender a Human is attracted to naturally, Maternal extinct, the kind of orgasm a person would be able to reach etc. So a human could look completely male in everyway, but essentially act like a female, which is generally called “gay”. Obviously there is no possible way to resolve this, mainly because we barely have any understanding of the condition. &lt;br&gt;&lt;br&gt;Finally, what makes these issues more complex than they already are is the fact that sexual ambiguity may not manifest until much later in life, when until then, a person could have been treated his / her whole life to the opposite of their real gender, causing permanent life devastation.  &lt;br&gt;&lt;br&gt;&lt;br&gt;&lt;br&gt;&lt;i&gt;P.S. If you like to understand this even further, google “Ambiguous Genitalia”. I will try to answer any questions in the comments section.&lt;/i&gt;&lt;br&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/677887814877325122-8109417642625556590?l=palestinianmd.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/8109417642625556590/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=677887814877325122&amp;postID=8109417642625556590' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/8109417642625556590'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/8109417642625556590'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/2008/11/sex-simplified.html' title='Sex: Simplified'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-677887814877325122.post-7813371753387319102</id><published>2008-11-14T08:49:00.000-08:00</published><updated>2008-11-14T08:50:12.556-08:00</updated><title type='text'>Medicine In The 80's: Dead Then, Alive Now</title><content type='html'>Some might think of the 80s to be the period of cheesy haircuts, fuzzy neons and a constantly morphing Michel Jackson.  To many, they still feel fresh and recent. There are many fields that have flourished significantly since the 80s. There is no need to emphasize how much has changed in the world of information technology since most of you are most likely well versed in that. However, many do not realize the humongous leaps that Medicine took during the past 25 years. Here, I will list a fraction of the major medical advancements that may have escaped many people, simply because they are currently taken for granted, but had you suffered from a condition that warranted some of those medical interventions, you most likely would have not received them then. &lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Cardiac Stents:&lt;/b&gt;&lt;/u&gt;&lt;br&gt;&lt;br&gt;Cardiac catheterization is a procedure where a cardiologist inserts a catheter into a peripheral artery or vein and follows the path of that vessel retrogradely until he reaches one of the chambers of the heart connected to that vessel.  What you might recognize mostly is the procedure we currently get if someone has a heart attack. Doctors who examine a heart attack patient (a.k.a. Myocardial infarction), would like to take a look at the patency of the arteries that feed your heart, we call the coronary arteries.&lt;br&gt;&lt;br&gt;This whole idea was actually first devised in 1939 by &lt;i&gt;Werner Forssmann&lt;/i&gt;. So you might ask yourself, what changed since the 80s? Stents. Prior to 1989, the main purpose of catheterization was to visualize and diagnose; they were also somewhat therapeutic by the use of balloons. Basically the catheter reaches to a clogged region of the coronary, and inflates a soft balloon to widen the lumen of the artery. That procedure was deemed inferior to what then used to be a very common surgery called coronary artery bypass graphting (CABG), which basically strips non-essential veins from the legs to be used to reconnect the area after a certain clog in the coronary to a major vessel, thereby resupplying the starved heart muscle with much needed blood. What that surgery meant was that a patient had to undergo a very risky operation where the chest is split wide open, the heart is frozen to a temperature close to zero, and the body for the duration of the surgery was supplied by blood via an artificial machine. &lt;br&gt; &lt;img src="http://www.nhlbi.nih.gov/health/dci/images/stent_lowres.gif" align="right" vspace="10" hspace="10"/&gt;&lt;br&gt;Stents are a small scaffold like structure that can be inserted into a clogged artery and placed to support the walls of the vessel after it has been ballooned, to keep it patent. Studies showed that there was no extra benefit for surgery over stents in many patients that would have received a chest splitting, heart freezing surgery. Instead, all what patients have to undergo now is go into a catheterization room for around 30 minutes, have a small incision in their right or left thighs, and have the catheter place a balloon and stent in a clogged coronary. Patients usually stay awake for the duration of the procedure. Stents were first reported to have been used in heart vessels in 1986 but it was not until 1989 when the &lt;i&gt;Palmaz-Schatz&lt;/i&gt; balloon-expandable intracoronary stent was developed, when it went mainstream. It is said to have reduced the number of cardiac surgeries by more than 60% since the 80s.   Amazing? I say Aye.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Laparoscopic Cholecystectomy&lt;/b&gt;&lt;/u&gt; (Removal of the Gall bladder by scopes):&lt;br&gt;&lt;br&gt;Stones, they are everywhere, in your garden, on your lawn, in the hands of kids in Palestine and in your gallbladder. Those pesky little pebbles of annoyance have many causes, and vary in nature depending on the region. But in the developed world, the most common are cholesterol stones. No surprise there.&lt;br&gt;&lt;br&gt;The incidence of gall stones is around 10% of the population averaged for both females and males. They are obviously extremely common. Those stones can stay in the gall bladder for years undetected. They get noticed when they cause complications, mainly when they clogged bile ducts that come out of the gall bladder and liver, leading to many dangerous conditions such as inflammation of the gallbladder (Cholecystitis) and inflammation of the pancreas (Pancreatitis). &lt;br&gt;&lt;br&gt;So if those little buggers needed to be removed, what had to be done? Basically, patients had to undergo a major operation, slashing the right half of your upper abdomen open. In addition it entailed a long stay at the hospital.  &lt;br&gt; &lt;img src="http://www.direct-healthcare.com/images/cholo.jpg" align="right" vspace="10" hspace="10"/&gt;&lt;br&gt;Laparoscopy is a procedure which uses mechanical aids and a fiber optic camera through very small well placed puncture holes in the abdomen, to be able to manipulate and/or remove contents in the abdomen. Laparoscopic Cholecystectomy is the use of that method to remove the gall bladder. This procedure was first popularized in the US by &lt;i&gt;Dr. Eddie Joe Reddick&lt;/i&gt; in 1989. Now it takes around 15 minutes to get rid of your gallbladder. Only 5% of all laparoscopic gallbladder surgeries may warrant the surgeon to convert to an open procedure. &lt;br&gt;&lt;br&gt;From an abdomen slashing multi-hour surgery, to a few puncture wounds you won’t notice done in 15 minutes. Amazing? I say aye.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Blood transfusion screening:&lt;/b&gt;&lt;/u&gt;&lt;br&gt;&lt;br&gt;Hepatitis C and HIV are major life shortening illnesses that debilitate the world. Needless to say, any method to achieve a reduction in the number of infected people is more than welcome. Prior to the mid 80s, none of the blood products used in blood transfusion were screened for either HIV or Hepatits C.&lt;br&gt;&lt;center&gt;&lt;img src="http://www.cosmosmagazine.com/system/files/20071009_blood.jpg"  vspace="10" hspace="10"/&gt;&lt;/center&gt;&lt;br&gt;What this meant, was basically that a person who just sustained a major trauma, or a person who is simply going into an operation for a repairable problem, could end up coming out with a major life threatening illness  had s/he needed a simple blood transfusion. Screening for HIV was not even developed to the lat 1980s, and screening for Hepatitis C was not a standard until 1992. Thanks to screening, this has improved significantly. It is next to impossible to receive any of those infections  through a simple blood transfusion currently. Essential? I say aye.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;The Internet:&lt;/b&gt;&lt;/u&gt;&lt;br&gt;&lt;br&gt;Yes folks, the intewebs. Aside from the fact that you can troll websites with false links to tits, and the almighty Porn, it actually can save lives. The applications are virtually limitless, and the benefits to mankind are humungous. &lt;br&gt;&lt;br&gt;Simple things that we take for granted were virtually impossible in the 80s.  Medical students can have access to what is equal to a library that could fill all floors of many skyscrapers. All of that knowledge can be accessed right from within one’s room. Updates, advancement and research in medicine were facilitated and catalyzed through the internet.&lt;br&gt;&lt;center&gt;&lt;img src="http://www.space.gc.ca/asc/img/apogee_0704_telehealth.jpg"  vspace="10" hspace="10"/&gt;&lt;/center&gt;&lt;br&gt;Other applications include the availability of correct health information to Patients who seek to know more about their conditions. In addition, radiologists could examine images from their homes if an emergency rises and they cannot be physically available at the hospital. A novel procedure could now be demonstrated live to the whole world, instead to only the few select people that could fit inside the operations room.  The standards of care extended to virtually all the regions that have access to the web, giving a new meaning to the word "standard". The benefits are clearly limitless. Amazing? I say aye.&lt;br&gt;&lt;br&gt;&lt;br&gt;&lt;i&gt;With this I conclude this article. Obviously I missed some major medical advancements, such as Genetic engineering, Cancer treatment and HIV anti-retroviral medications. Boring you is not my objective. If you were bored, I apologize. If you weren’t, I am glad. Either way, I thank you for reading all the way to this sentence. &lt;/i&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/677887814877325122-7813371753387319102?l=palestinianmd.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/7813371753387319102/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=677887814877325122&amp;postID=7813371753387319102' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/7813371753387319102'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/7813371753387319102'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/2008/11/medicine-in-80s-dead-then-alive-now.html' title='Medicine In The 80&apos;s: Dead Then, Alive Now'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-677887814877325122.post-5212897783834989988</id><published>2008-11-14T08:46:00.000-08:00</published><updated>2008-11-14T08:48:35.416-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Muslim'/><category scheme='http://www.blogger.com/atom/ns#' term='Civilization'/><category scheme='http://www.blogger.com/atom/ns#' term='Scientists'/><category scheme='http://www.blogger.com/atom/ns#' term='Islamic'/><title type='text'>Tribute to A Lost Civilization</title><content type='html'>This article is set to blow layers of dust that settled over a seemingly lost civilization. In the current world we live in, Arabs and Muslims are generally viewed as a backward culture that lives in wide barren wastelands and sandy deserts in tents and travel using camels.  All thanks to Western Pop culture and media. &lt;br&gt;&lt;br&gt;However, this was/is not the case. There was a time period, which extended for many centuries where this civilization ruled the earth, not only militarily, but also scientifically. This article is a tribute to the people that have lead to much scientific advancement that is long forgotten.  It is, in my opinion, not meant to show Islam in any better light, but rather show the ease with which those people managed to think critically about science, without much hindrance from religion, even though most of them lived almost a thousand years ago, unlike many “modern” religious figures that have no understanding of science, and yet intervene with it every day.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Al-Jahiz&lt;/u&gt;&lt;/b&gt;  (781 A.D- 868 A.D.)&lt;br&gt; &lt;img src="http://www.islam.org.br/Al_Jahiz.gif" align="right" hspace="5"/&gt;&lt;br&gt; A famous Afro-Arab scholar, of East African descent who was born to a poor family in Basra. He had great knowledge on Greek philosophy, Arabic poetry, Biology, Zoology and pre Islamic Persian history.&lt;br&gt;Among his most notable contributions, was The Book of Animals (&lt;i&gt;Kitab al-Hayawan&lt;/i&gt;). Its an Encyclopedia of seven volumes that described in details more than 350 different Animal species. He advanced and put theories that were cornerstones in the development of the theory of evolution. &lt;br&gt;&lt;br&gt;&lt;i&gt;"Animals engage in a struggle for existence; for resources, to avoid being eaten and to breed. Environmental factors influence organisms to develop new characteristics to ensure survival, thus transforming into new species. Animals that survive to breed can pass on their successful characteristics to offspring."&lt;/i&gt; &lt;br&gt;&lt;br&gt;He also suggested that different environmental factors were behind the development of certain Animal and Human characteristics such as black skin color.&lt;br&gt;&lt;br&gt;&lt;i&gt;"[It] is so unusual that its gazelles and ostriches, its insects and flies, its foxes, sheep and asses, its horses and its birds are all black. Blackness and whiteness are in fact caused by the properties of the region, as well as by the God-given nature of water and soil and by the proximity or remoteness of the sun and the intensity or mildness of its heat."&lt;/i&gt;&lt;br&gt;&lt;br&gt;He was also known for his satirical writings, and is considered by many the greatest writer of the ninth century, and one of the best of all time. He advanced most of his knowledge while living in Baghdad and died in Basra on 868 AD.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Al-Khwarizmi&lt;/b&gt;&lt;/u&gt; (780-850 AD) &lt;br&gt; &lt;img src="http://www.math.uconn.edu/General/Pictures/Mathematicians160x214/Al_Khwarizmi.jpg" align="right" hspace="5"/&gt;&lt;br&gt;A famous Persian Islamic mathematician and astronomer. He was the writer of the famous book called &lt;i&gt;Al-Jaber&lt;/i&gt;, which is the term that derived what you would readily recognize as “Algebra”.  Thus he is considered the father of algebra. &lt;br&gt;&lt;br&gt;His use of systemic thinking for solving linear and quadratic equations were the very foundations of algebra as we know it today, and shaped many other facets of science. &lt;br&gt;&lt;br&gt;His other major contribution was in the area of Geography. He wrote the &lt;i&gt;“Book on the appearance of the Earth”&lt;/i&gt;.  The book opens with the list of latitudes and longitudes, in order of "weather zones", that is to say in blocks of latitudes and, in each weather zone, by order of longitude. He also assisted in the construction of a world map for the caliph al-Ma'mun and participated in a project to determine the circumference of the Earth, supervising the work of 70 geographers to create the map of the then "known world". &lt;br&gt; &lt;center&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/05.jpg"  hspace="5" vspace="5"/&gt;&lt;/center&gt;&lt;br&gt;He lived most of his life in the eastern part of the Persian territory now part of Uzbekistan.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Ibn Seena:&lt;/b&gt;&lt;/u&gt; (980-1037 A.D.)&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/Avicenna_Persian_Physician-1.jpg"  align="right" hspace="5" vspace="5"/&gt;&lt;br&gt; &lt;br&gt;Also known by his Latin name &lt;i&gt;“Avicenna”&lt;/i&gt;. He was a Persian Muslim and was known to be the foremost Physician and Philosopher of his time.  He was born in Persia around 980 in Afshana, in Bukhara province, his mother's home, a small city now part of Uzbekistan. &lt;br&gt;&lt;br&gt;Ibn Seena is regarded as the father of early modern medicine. His most major contribution was &lt;i&gt;“The Canon of Medicine”&lt;/i&gt;. It was considered a standard medical textbook in many Islamic and European Universities up until the early 19th century.  His contributions include his discovery of the contagious nature of infectious diseases, the introduction of quarantine to limit the spread of contagious diseases, the introduction of experimental medicine, evidence-based medicine, clinical trials, randomized controlled trials, efficacy tests, clinical pharmacology, neuropsychiatry, risk factor analysis, and the idea of a syndrome, and the importance of dietetics and the influence of climate and environment on health. He is also considered the father of the fundamental concept of momentum in physics, and regarded as a pioneer of aromatherapy.&lt;br&gt;&lt;br&gt;His main other significant contribution was to philosophy. He was the founder of Avicennian logic and the philosophical school of Avicennism, which were influential among both Muslim and Scholastic thinkers. Ibn Seena was also a pioneer in Physics. He was the first to employ air thermometer to measure air temperature.  In addition, he put down an elaborate theory of motion.&lt;br&gt;Most of his works were written in Arabic - which was the de facto scientific language of that time.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Ibn al-Nafis:&lt;/b&gt;&lt;/u&gt;(1213-1288 A.D.)&lt;img src="http://www.islamset.com/isc/nafis/images/nafis.jpg"  align="right" hspace="5" vspace="5"/&gt;&lt;br&gt;&lt;br&gt;He was an Arab and a Muslim physician, anatomist, physiologist, surgeon, ophthalmologist. He was born in 1213 in Damascus, Syria.  He grew up in a time of political turmoil in Syria and Egypt, during the Crusades and Mongol invasions. He attended the Medical College Hospital &lt;i&gt;"Bimaristan al-Noori"&lt;/i&gt; in Damascus. He worked at the &lt;i&gt;Al-Nassri&lt;/i&gt; Hospital, and subsequently at the &lt;i&gt;Al-Mansouri&lt;/i&gt; Hospital, where he became the "Chief of Physicians".&lt;br&gt;&lt;br&gt;Ibn al-Nafis is most famous for being the first physician to describe the pulmonary circulation, and the capillary, and coronary circulations, which form the basis of the circulatory system, for which he is considered the father of circulatory physiology and "the greatest physiologist of the Middle Ages”. &lt;center&gt;&lt;img src="http://i198.photobucket.com/albums/aa143/medicine_freak/Fig201220panarab20anesthesia20journ.jpg"   hspace="5" vspace="10"/&gt;&lt;/center&gt;  This contribution was mainly manifested in his most famous work, “Commentary on Anatomy in Avicenna's Canon” and “The Comprehensive Book on Medicine”; comprised of more than 350 volumes. It is one of the largest known medical encyclopedia in history.&lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Abu al-Qasim al-Zahrawi:&lt;/b&gt;&lt;/u&gt; (936 - 1013 A.D.)&lt;img src="http://upload.wikimedia.org/wikipedia/en/c/c2/Albucasis.gif"  align="right" hspace="5" vspace="5"/&gt;&lt;br&gt;&lt;br&gt;Known in the west as &lt;i&gt;Abulcasis&lt;/i&gt;, was an Andalusian-Arab physician, surgeon. Abu al-Qasim was born in the city of El Zahra, six miles northwest of Córdoba, Spain. He lived most of his life in Córdoba. It is also where he studied, taught and practiced medicine and surgery until shortly before his death in about 1013 A.D.&lt;br&gt; &lt;br&gt;He is considered the father of modern surgery, and one of the greatest medieval surgeons. Al-Qasim was a surgeon and specialized in curing disease by cauterization. He also invented hundreds of devices used during surgery that were described extensively in his book &lt;i&gt;“Al-Tasrif”&lt;/i&gt; (The Method of Medicine). Many of the redesigns of his tools are used in the operation room till this day. His use of catgut for internal stitching is still practiced in modern surgery.&lt;center&gt;&lt;img src="http://upload.wikimedia.org/wikipedia/en/3/35/Al-zahrawi_surgical_tools.gif"   hspace="5" vspace="10"/&gt;&lt;/center&gt;&lt;br&gt; &lt;br&gt;The street in Cordoba where he lived is named in his honor as &lt;i&gt;"Calle Albucasis"&lt;/i&gt;. On this street he lived in house no. 6, which is preserved today by the Spanish Tourist Board with a bronze plaque (awarded in January 1977) which reads: &lt;br&gt;&lt;br&gt;&lt;i&gt;"This was the house where lived Abul-Qasim."&lt;/i&gt; &lt;br&gt;&lt;br&gt;&lt;b&gt;&lt;u&gt;Ibn al-Haytham:&lt;/b&gt;&lt;/u&gt;(965 – 1039 A.D.)&lt;img src="http://upload.wikimedia.org/wikipedia/commons/7/7f/Ibn_haithem_portrait.jpg"  align="right" hspace="5" vspace="5"/&gt;&lt;br&gt;&lt;br&gt;Also known in the West as Alhacen or Alhazen, he was an Arab Muslim polymath who made significant contributions to the principles of optics, ophthalmology and medicine. Ibn al-Haytham was born in 965 in Basra, and was educated there and in Baghdad, Iraq, then under the rule of the Buyid dynasty of Persia, and died in Cairo, Egypt.&lt;br&gt;&lt;br&gt;Ibn al-Haytham was a pioneer in optics, ophthalmology and physics. His pioneering work on number theory, analytic geometry, and the link between algebra and geometry, influenced many well known Western scientists, such as Isaac Newton’s Calculus. Ibn al-Haytham's most famous work is his seven volume treatise on optics, &lt;i&gt;"Kitab al-Manazir"&lt;/i&gt; (Book of Optics), which has been ranked alongside Isaac Newton's Philosophiae Naturalis Principia Mathematica as one of the most influential books in physics. Ibn al-Haytham laid the very foundations of the scientific method. This included observation, statement of problem, formulation of hypothesis, testing of hypothesis using experimentation, analysis of experimental results, interpretation of data and formulation of conclusion and publication of findings. Among his other achievements, Ibn al-Haytham gave the first clear description and correct analysis of the &lt;i&gt;camera obscura.&lt;/i&gt; &lt;br&gt;&lt;br&gt;&lt;br&gt;This concludes this article, but definitely does not do justice to the scores of Arab and Muslim scholars and scientists who I failed to mention in this attempted glimpse at history. Hopefully, and depending on time constraints, I would write more articles about other equally worthy names, that would include 5 in each article. Thanks for reading.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/677887814877325122-5212897783834989988?l=palestinianmd.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://palestinianmd.blogspot.com/feeds/5212897783834989988/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=677887814877325122&amp;postID=5212897783834989988' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/5212897783834989988'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/677887814877325122/posts/default/5212897783834989988'/><link rel='alternate' type='text/html' href='http://palestinianmd.blogspot.com/2008/11/tribute-to-lost-civilization.html' title='Tribute to A Lost Civilization'/><author><name>Medfreak</name><uri>http://www.blogger.com/profile/11927655710588803552</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry></feed>
