Friday, November 14, 2008

The Most Ancient Language in The Universe

The Most Ancient Language in the Universe


Arabic, Latin, English, Hebrew, Aramaic and Persian are all well known languages, but can there be a language that predates humanity itself by millions of years? Before we answer that question, we need to figure out what “Language” actually is. Some say it is a set of visual symbols, auditory sounds or tactile markings that serve the purpose of documentation and communication. Some would like to add the fact that language is a strictly human trait, and other life forms may have some sort of communication, but did not rise up to the level of becoming a language. I will not try to argue on behalf of microbes, plants or even animals. No, I will argue on behalf of Life.

The language of life is the Genetic Code. It is indeed a very sophisticated linguistic system that provides the means for documentation and communication not only between cells of the same species, but also between different life forms. The Genetic code documents every single evolutionary advancement in various organisms, and preserves that advancement for future siblings of that species.

What is the Genetic Code?

The Genetic code is basically a long chain of molecules that are formed by four different kinds of molecules we call nucleotides, similar to the letters of the alphabet. Most of you have probably heard of the binary language in modern computers which is composed of a chain of zeros and ones that are meant to execute a certain function or store a certain piece of information for future retrieval. So a typical looking strip of binary code would look like:

1101110101011101111100101110

Similarly, the Genetic Code is a chain made of four different nucleotides; Adenine, Guanine, Thymine and Cytosine (A, G, T and C), that are attached to each other to form a single long strand of DNA. Each of those nucleotides has a natural complementary nucleotide we call a base pair. So a C would always pair with a G, and an A would always pair with a T. Thus each strand would have a mirror image of complementary DNA strand. Since one strand is enough to know how the other strand looks like, we need to only list the sequence of one strand to make out the genetic code. A typical genetic code strip would look like this:

CGATTCATGTATGCTGAGACTAGCCTCACGGAGCT

How exactly is this a language?

Well the DNA itself is not a language, it is a storage medium of the genetic code similar to a hard disk in your PC. But what it stores, is the language that codes how to create a life form from scratch. It is a language in the sense that it contains a set of symbols signified by a pattern of nucleotides that serve the purpose of documenting the life form’s entire structure, and is universally understood by all cells known in existence.

For example, Insulin, which is a hormone that is important in sugar regulation, is also an important drug to treat diabetics. It is a protein, which is coded for by a gene (a segment in the DNA that is designated for a certain function or codes a molecular structure, mostly proteins). The way we produce it, is by taking a “refined” copy of the human DNA and place it inside a simple bacterial cell. Then the bacteria are grown in cultures and eventually we will have massive amount of bacteria that is capable of producing Insulin in [1]. The important point to note here is that the simplest of life forms, bacteria, are capable of understanding the genetic code of one of the most complex life forms in existence, a Human Being. This is a prime example of how universal the Genetic code is as a language.

How do organisms decode the Genetic code?

Trying to avoid all the technicalities might be difficult here, but I will try to simplify as much as possible. As we mentioned earlier, the DNA is a set of molecules of four types. The “coding” part of the DNA is coded in non-overlapping triplets. So basically each three molecules (e.g. ACT) corresponds to a certain amino acid, the building block of proteins. A gene would code for the entire amino acid chain that would form a protein. Cells have the machinery to recognize each triplet and what amino acid it corresponds for. This code is universal to all living cells, from Bacteria all the way to Human cells.


Can you at least tell me some interesting facts about the DNA?

Alright:

• Each cell has on average 6,000,000,000 base pairs forming the genetic code. If we want to write each base in letters, then we can simply consider each one to be the equivalent of a single byte. Taking that into consideration, each cell of yours actually contains the equivalent of an astonishing 6 GBs of data. Now take the fact that each human body is formed of roughly 10,000,000,000,000 cells, and each cell has a copy of the human genome, that computes into 60,000,000,000 Terabytes of Data! So basically, each human contains more data than entire computer mainframes spanning a few buildings. [2].

• Each base pair is roughly 0.34 × 10-9 m long. If we unravel all the base pairs that make the DNA in one single human being and line them up next to each other in a single line, each human would have enough DNA to make 67 round trips to the sun, 52000 trips to the moon and enough to wrap it around the earth’s circumference 500,000 times! [2] [3]

• The cell is capable of replicating the entire genetic code, while making less than a single error in a billion copied base pairs. That is like copying 1 Gigabyte of data and making an error of one byte.[4]

• More than 90% of the Human DNA is either of no function, redundant, or of unknown function.

• The DNA is a great museum that documents evolutionary changes. For example, Apes in general have 48 chromosomes, while Humans carry only 46 chromosomes. About 18 years ago, scientists discovered that two chromosomes in Apes fused together to form the second chromosome in humans. This fusion lead to the fact that Humans have one pair of chromosomes less than other descendents of apes. [5]

Final thoughts :

The Genetic code could very well be the oldest and most sophisticated language to date, and we have yet to understand a fraction of it. In essence, the Human body is far more sophisticated than what its inhabitant gives it credit for.

P.S. If you like to do further reading, you may start by checking the links to the sources I cited.